Review



sgrna scaffolds sequence  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc sgrna scaffolds sequence
    Sgrna Scaffolds Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 41 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+scaffold+sequence/pSLQ1651-sgTelomere(F%2BE)+(Plasmid+%2351024)/pm38961283-241-11-15
    Average 94 stars, based on 41 article reviews
    sgrna scaffolds sequence - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: p62 filaments capture and present ubiquitinated cargos for autophagy.
    Article Snippet: .. Two guide RNAs were designed close to the start codon of p62 using the web tool crispr.mit.edu (Hsu et al, 2013), and cloned individually into the sgRNA scaffold sequence of pSpCas9n(BB)-2A-Puro (PX462) V2.0 from the Zhang Lab, Addgene entry #62987 (Guide A: 50CGCGGCTTTTGTAGCGAACGCGG; Guide B: 50CGCCAGCTCGCCGCTCGCTATGG). ..

    Clone Assay:

    Article Title: p62 filaments capture and present ubiquitinated cargos for autophagy.
    Article Snippet: .. Two guide RNAs were designed close to the start codon of p62 using the web tool crispr.mit.edu (Hsu et al, 2013), and cloned individually into the sgRNA scaffold sequence of pSpCas9n(BB)-2A-Puro (PX462) V2.0 from the Zhang Lab, Addgene entry #62987 (Guide A: 50CGCGGCTTTTGTAGCGAACGCGG; Guide B: 50CGCCAGCTCGCCGCTCGCTATGG). ..

    Sequencing:

    Article Title: p62 filaments capture and present ubiquitinated cargos for autophagy.
    Article Snippet: .. Two guide RNAs were designed close to the start codon of p62 using the web tool crispr.mit.edu (Hsu et al, 2013), and cloned individually into the sgRNA scaffold sequence of pSpCas9n(BB)-2A-Puro (PX462) V2.0 from the Zhang Lab, Addgene entry #62987 (Guide A: 50CGCGGCTTTTGTAGCGAACGCGG; Guide B: 50CGCCAGCTCGCCGCTCGCTATGG). ..

    Article Title: Micronucleus is not a potent inducer of the cGAS/STING pathway
    Article Snippet: LentiCRISPR.v2 (#52961; addgene) was mutagenized to introduce R691A to generate HiFi Cas9. pCAG-enAsCas12a-HF1(E174R/N282A/S542R/K548R)-NLS(nuc)-3xHA (#107942; addgene) was used to obtain Lenti-enAsCas12a-HF1-2C-NLS, during which one more NLS was added to the C-terminus to improve its efficiency ( ). .. LentiGuide-puro (#52963; addgene) and an improved sgRNA scaffold sequence from pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W (#67979; addgene) were used to generate the LentiGuide-puro-sgFUSION21-C+5 bp plasmid. pH2B-miRFP703 (#80001; addgene) and pCSII-EF-mVenus-hGeminin(1/110) (RDB15271) were used to generate pCSII-EF-emiRFP703-Geminin(1–110), during which the N-terminal sequence of miRFP703 was modified to obtain emiRFP703 ( ). .. For cloning of the Sister-Control (SC) cassette plasmid (pMTH857) used for genomic integration, synthetic DNA fragments (Integrated DNA Technologies) were introduced into the original sister cassette plasmid (pMTH397) ( ).

    Article Title: Micronucleus Is Not a Potent Inducer of cGAS-STING Pathway
    Article Snippet: LentiCRISPR.v2 (addgene #52961) was mutagenized to introduce R691A to generate HiFi Cas9. pCAG-enAsCas12a-HF1(E174R/N282A/S542R/K548R)-NLS(nuc)-3xHA (addgene #107942) was used to obtain Lenti-enAsCas12a-HF1-2C-NLS, during which one more NLS was added to the C-terminus to improve its efficiency ( ). .. LentiGuide-puro (addgene #52963) and an improved sgRNA scaffold sequence from pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W (addgene #67979) were used to generate LentiGuide-puro-sgFUSION21-C+5bp plasmid. pH2B-miRFP703 (addgene #80001) and pCSII-EF-mVenus-hGeminin(1/110) (RDB15271) were used to generate pCSII-EF-emiRFP703-Geminin(1-110), during which the N-terminal sequence of miRFP703 was modified to obtain emiRFP703 ( ). .. An improved rtTA3G was artificially synthesized (Integrated DNA Technologies) to obtain pLenti-rtTA3G ( ). pCW-Cas9 (addgene #50661) was modified to generate pTRE3G-miRFP670nano-p2a-Cas9(HiFi), during which the puroR-t2a-rtTA sequence was removed. miRFP670nano was artificially synthesized (Integrated DNA Technologies) ( ).


    Plasmid Preparation:

    Article Title: Micronucleus is not a potent inducer of the cGAS/STING pathway
    Article Snippet: LentiCRISPR.v2 (#52961; addgene) was mutagenized to introduce R691A to generate HiFi Cas9. pCAG-enAsCas12a-HF1(E174R/N282A/S542R/K548R)-NLS(nuc)-3xHA (#107942; addgene) was used to obtain Lenti-enAsCas12a-HF1-2C-NLS, during which one more NLS was added to the C-terminus to improve its efficiency ( ). .. LentiGuide-puro (#52963; addgene) and an improved sgRNA scaffold sequence from pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W (#67979; addgene) were used to generate the LentiGuide-puro-sgFUSION21-C+5 bp plasmid. pH2B-miRFP703 (#80001; addgene) and pCSII-EF-mVenus-hGeminin(1/110) (RDB15271) were used to generate pCSII-EF-emiRFP703-Geminin(1–110), during which the N-terminal sequence of miRFP703 was modified to obtain emiRFP703 ( ). .. For cloning of the Sister-Control (SC) cassette plasmid (pMTH857) used for genomic integration, synthetic DNA fragments (Integrated DNA Technologies) were introduced into the original sister cassette plasmid (pMTH397) ( ).

    Article Title: Micronucleus Is Not a Potent Inducer of cGAS-STING Pathway
    Article Snippet: LentiCRISPR.v2 (addgene #52961) was mutagenized to introduce R691A to generate HiFi Cas9. pCAG-enAsCas12a-HF1(E174R/N282A/S542R/K548R)-NLS(nuc)-3xHA (addgene #107942) was used to obtain Lenti-enAsCas12a-HF1-2C-NLS, during which one more NLS was added to the C-terminus to improve its efficiency ( ). .. LentiGuide-puro (addgene #52963) and an improved sgRNA scaffold sequence from pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W (addgene #67979) were used to generate LentiGuide-puro-sgFUSION21-C+5bp plasmid. pH2B-miRFP703 (addgene #80001) and pCSII-EF-mVenus-hGeminin(1/110) (RDB15271) were used to generate pCSII-EF-emiRFP703-Geminin(1-110), during which the N-terminal sequence of miRFP703 was modified to obtain emiRFP703 ( ). .. An improved rtTA3G was artificially synthesized (Integrated DNA Technologies) to obtain pLenti-rtTA3G ( ). pCW-Cas9 (addgene #50661) was modified to generate pTRE3G-miRFP670nano-p2a-Cas9(HiFi), during which the puroR-t2a-rtTA sequence was removed. miRFP670nano was artificially synthesized (Integrated DNA Technologies) ( ).


    Modification:

    Article Title: Micronucleus is not a potent inducer of the cGAS/STING pathway
    Article Snippet: LentiCRISPR.v2 (#52961; addgene) was mutagenized to introduce R691A to generate HiFi Cas9. pCAG-enAsCas12a-HF1(E174R/N282A/S542R/K548R)-NLS(nuc)-3xHA (#107942; addgene) was used to obtain Lenti-enAsCas12a-HF1-2C-NLS, during which one more NLS was added to the C-terminus to improve its efficiency ( ). .. LentiGuide-puro (#52963; addgene) and an improved sgRNA scaffold sequence from pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W (#67979; addgene) were used to generate the LentiGuide-puro-sgFUSION21-C+5 bp plasmid. pH2B-miRFP703 (#80001; addgene) and pCSII-EF-mVenus-hGeminin(1/110) (RDB15271) were used to generate pCSII-EF-emiRFP703-Geminin(1–110), during which the N-terminal sequence of miRFP703 was modified to obtain emiRFP703 ( ). .. For cloning of the Sister-Control (SC) cassette plasmid (pMTH857) used for genomic integration, synthetic DNA fragments (Integrated DNA Technologies) were introduced into the original sister cassette plasmid (pMTH397) ( ).

    Article Title: Micronucleus Is Not a Potent Inducer of cGAS-STING Pathway
    Article Snippet: LentiCRISPR.v2 (addgene #52961) was mutagenized to introduce R691A to generate HiFi Cas9. pCAG-enAsCas12a-HF1(E174R/N282A/S542R/K548R)-NLS(nuc)-3xHA (addgene #107942) was used to obtain Lenti-enAsCas12a-HF1-2C-NLS, during which one more NLS was added to the C-terminus to improve its efficiency ( ). .. LentiGuide-puro (addgene #52963) and an improved sgRNA scaffold sequence from pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W (addgene #67979) were used to generate LentiGuide-puro-sgFUSION21-C+5bp plasmid. pH2B-miRFP703 (addgene #80001) and pCSII-EF-mVenus-hGeminin(1/110) (RDB15271) were used to generate pCSII-EF-emiRFP703-Geminin(1-110), during which the N-terminal sequence of miRFP703 was modified to obtain emiRFP703 ( ). .. An improved rtTA3G was artificially synthesized (Integrated DNA Technologies) to obtain pLenti-rtTA3G ( ). pCW-Cas9 (addgene #50661) was modified to generate pTRE3G-miRFP670nano-p2a-Cas9(HiFi), during which the puroR-t2a-rtTA sequence was removed. miRFP670nano was artificially synthesized (Integrated DNA Technologies) ( ).

    Expressing:


    Generated:


    Cloning:




    Similar Products

    sgrna scaffolds sequence  (Addgene inc)
    94
    Addgene inc sgrna scaffolds sequence
    Sgrna Scaffolds Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+scaffold+sequence/pSLQ1651-sgTelomere(F%2BE)+(Plasmid+%2351024)/pm38961283-241-11-15
    Average 94 stars, based on 1 article reviews
    sgrna scaffolds sequence - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    sgrna1 scaffold u6 promoter sgrna2 sequence  (Addgene inc)
    95
    Addgene inc sgrna1 scaffold u6 promoter sgrna2 sequence
    Sgrna1 Scaffold U6 Promoter Sgrna2 Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+scaffold+sequence/sgRNA+with+U6+promoter+(Plasmid+%2348962)/pm38582932-210-2-21
    Average 95 stars, based on 1 article reviews
    sgrna1 scaffold u6 promoter sgrna2 sequence - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    sgrna scaffold sequence  (Addgene inc)
    93
    Addgene inc sgrna scaffold sequence
    Sgrna Scaffold Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+scaffold+sequence/pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W+(Plasmid+%2367979)/pmc10837050-195-6-12
    Average 93 stars, based on 1 article reviews
    sgrna scaffold sequence - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    containing the t7 promoter, the predicted sgrna sequence, and a 16 nt sgrna scaffold sequence  (Oligos Etc)
    90
    Oligos Etc containing the t7 promoter, the predicted sgrna sequence, and a 16 nt sgrna scaffold sequence
    Containing The T7 Promoter, The Predicted Sgrna Sequence, And A 16 Nt Sgrna Scaffold Sequence, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+scaffold+sequence/containing+the+t7+promoter++the+predicted+sgrna+sequence++and+a+16+nt+sgrna+scaffold+sequence/10__21769_slash_bioprotoc__5092-142-8-1
    Average 90 stars, based on 1 article reviews
    containing the t7 promoter, the predicted sgrna sequence, and a 16 nt sgrna scaffold sequence - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    spcas9 sgrna scaffold 3 sequences  (Addgene inc)
    96
    Addgene inc spcas9 sgrna scaffold 3 sequences
    Spcas9 Sgrna Scaffold 3 Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+scaffold+sequence/lentiCRISPR+v2+(Plasmid+%2352961)/pmc10073897-373-22-33
    Average 96 stars, based on 1 article reviews
    spcas9 sgrna scaffold 3 sequences - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier

    Image Search Results